86
|
Merck & Co
gapdh forward Gapdh Forward, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pmc12281364__mmc2-633-236-239?v=Merck+%26+Co Average 86 stars, based on 1 article reviews
gapdh forward - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) Gapdh (Forward Primer: 5′–Aatcccatcaccatcttcca–3′; Reverse Primer: 5′–Tggactccacgacgtactca–3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pmc11280363-36-11-21?v=GenScript+corporation Average 90 stars, based on 1 article reviews
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
ShineGene Bio-Technologies
gapdh; (glyceraldehyde 3-phosphate dehydrogenase: 5#ccactcctccaccttt gac3# (forward), 5##accctgttgctgtagcca3# (reverse) Gapdh; (Glyceraldehyde 3 Phosphate Dehydrogenase: 5#Ccactcctccaccttt Gac3# (Forward), 5##Accctgttgctgtagcca3# (Reverse), supplied by ShineGene Bio-Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pm21296766-69-53-70?v=ShineGene+Bio-Technologies Average 90 stars, based on 1 article reviews
gapdh; (glyceraldehyde 3-phosphate dehydrogenase: 5#ccactcctccaccttt gac3# (forward), 5##accctgttgctgtagcca3# (reverse) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gapdh, forward 5’-tgacttcaacagcgacaccca-3’ and reverse 5’-caccctgttgctgtagccaaa-3’ Gapdh, Forward 5’ Tgacttcaacagcgacaccca 3’ And Reverse 5’ Caccctgttgctgtagccaaa 3’, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pmc05187919-153-26-30?v=GenScript+corporation Average 90 stars, based on 1 article reviews
gapdh, forward 5’-tgacttcaacagcgacaccca-3’ and reverse 5’-caccctgttgctgtagccaaa-3’ - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
gapdh forward primer 5’-tcggagtcaacggatttggt-3  Gapdh Forward Primer 5’ Tcggagtcaacggatttggt 3, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pmc09986521-53-0-5?v=Microsynth+ag Average 90 stars, based on 1 article reviews
gapdh forward primer 5’-tcggagtcaacggatttggt-3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
primer gapdh-forward  Primer Gapdh Forward, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pmc06876861-100-0-4?v=Microsynth+ag Average 90 stars, based on 1 article reviews
primer gapdh-forward - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
PRIMER-E
gapdh-forward primer, 5′-tggagtctactggcgtctt-3′ Gapdh Forward Primer, 5′ Tggagtctactggcgtctt 3′, supplied by PRIMER-E, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pmc06130572-54-38-23?v=PRIMER-E Average 90 stars, based on 1 article reviews
gapdh-forward primer, 5′-tggagtctactggcgtctt-3′ - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
forward reverse primers genes interest gapdh endogenous reference control Forward Reverse Primers Genes Interest Gapdh Endogenous Reference Control, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pm28329820-141-11-22?v=Microsynth+ag Average 90 stars, based on 1 article reviews
forward reverse primers genes interest gapdh endogenous reference control - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Gallus BioPharmaceuticals
gapdh forward  Gapdh Forward, supplied by Gallus BioPharmaceuticals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pmc10301476-5-1-0?v=Gallus+BioPharmaceuticals Average 90 stars, based on 1 article reviews
gapdh forward - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Nihon Gene Research Laboratories
gapdh (forward) tgaacg ggaagctcactgg Gapdh (Forward) Tgaacg Ggaagctcactgg, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pm17641024-85-22-41?v=Nihon+Gene+Research+Laboratories Average 90 stars, based on 1 article reviews
gapdh (forward) tgaacg ggaagctcactgg - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
gapdh forward primer 50-tcggagtcaacggatttggt-30 Gapdh Forward Primer 50 Tcggagtcaacggatttggt 30, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/pm36890793-251-0-4?v=Microsynth+ag Average 90 stars, based on 1 article reviews
gapdh forward primer 50-tcggagtcaacggatttggt-30 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
SuperArray Bioscience Corporation
gapdh and puma5 primer sets (including forward and reverse primers) Gapdh And Puma5 Primer Sets (Including Forward And Reverse Primers), supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gapdh+forward/10__1074_slash_jbc__m110__193714-66-3-19?v=SuperArray+Bioscience+Corporation Average 90 stars, based on 1 article reviews
gapdh and puma5 primer sets (including forward and reverse primers) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Inflammation modulates intercellular adhesion and mechanotransduction in human epidermis via ROCK2
doi: 10.1016/j.isci.2023.106195
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Permeability, Gene Expression, Software
Journal: Cell reports
Article Title: GEF-H1 Signaling upon Microtubule Destabilization Is Required for Dendritic Cell Activation and Specific Anti-tumor Responses
doi: 10.1016/j.celrep.2019.08.057
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet:
Techniques: Virus, Plasmid Preparation, Construct, Recombinant, Western Blot, Selection, Enzyme-linked Immunosorbent Assay, Cell Isolation, cDNA Synthesis, SYBR Green Assay, Sample Prep, Library Quantification, Software, Imaging
Journal: Life
Article Title: Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11)
doi: 10.3390/life13061267
Figure Lengend Snippet: Sequences of primers used in this study.
Article Snippet:
Techniques: Sequencing, Marker